Skip to ContentGo to accessibility page
OpenStax Logo
Biology 2e

Critical Thinking Questions

Biology 2eCritical Thinking Questions

Critical Thinking Questions

19.

Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about the genetic code, what would be the shortest possible codon length? Explain.

20.

Discuss how degeneracy of the genetic code makes cells more robust to mutations.

21.

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG

What is the sequence of the amino acid chain this mRNA makes when it is translated?

22.

If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?

23.

In your own words, describe the difference between rho-dependent and rho-independent termination of transcription in prokaryotes.

24.

A fragment of bacterial DNA reads:

3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’

Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

25.

A scientist observes that a cell has an RNA polymerase deficiency that prevents it from making proteins. Describe three additional observations that would together support the conclusion that a defect in RNA polymerase I activity, and not problems with the other polymerases, causes the defect.

26.

Chronic lymphocytic leukemia patients often harbor nonsense mutations in their spliceosome machinery. Describe how this mutation of the spliceosome would change the final location and sequence of a pre-mRNA.

27.

Transcribe and translate the following DNA sequence (nontemplate strand): 5'-ATGGCCGGTTATTAAGCA-3'

28.

Explain how single nucleotide changes can have vastly different effects on protein function.

29.

A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)

Citation/Attribution

This book may not be used in the training of large language models or otherwise be ingested into large language models or generative AI offerings without OpenStax's permission.

Want to cite, share, or modify this book? This book uses the Creative Commons Attribution License and you must attribute OpenStax.

Attribution information
  • If you are redistributing all or part of this book in a print format, then you must include on every physical page the following attribution:

    Access for free at https://openstax.org/books/biology-2e/pages/1-introduction

  • If you are redistributing all or part of this book in a digital format, then you must include on every digital page view the following attribution:

    Access for free at https://openstax.org/books/biology-2e/pages/1-introduction

Citation information

© Apr 7, 2026 OpenStax. Textbook content produced by OpenStax is licensed under a Creative Commons Attribution License . The OpenStax name, OpenStax logo, OpenStax book covers, OpenStax CNX name, and OpenStax CNX logo are not subject to the Creative Commons license and may not be reproduced without the prior and express written consent of Rice University.