Skip to Content
OpenStax Logo
Biology 2e

Critical Thinking Questions

Biology 2eCritical Thinking Questions
Buy book
  1. Preface
  2. The Chemistry of Life
    1. 1 The Study of Life
      1. Introduction
      2. 1.1 The Science of Biology
      3. 1.2 Themes and Concepts of Biology
      4. Key Terms
      5. Chapter Summary
      6. Visual Connection Questions
      7. Review Questions
      8. Critical Thinking Questions
    2. 2 The Chemical Foundation of Life
      1. Introduction
      2. 2.1 Atoms, Isotopes, Ions, and Molecules: The Building Blocks
      3. 2.2 Water
      4. 2.3 Carbon
      5. Key Terms
      6. Chapter Summary
      7. Visual Connection Questions
      8. Review Questions
      9. Critical Thinking Questions
    3. 3 Biological Macromolecules
      1. Introduction
      2. 3.1 Synthesis of Biological Macromolecules
      3. 3.2 Carbohydrates
      4. 3.3 Lipids
      5. 3.4 Proteins
      6. 3.5 Nucleic Acids
      7. Key Terms
      8. Chapter Summary
      9. Visual Connection Questions
      10. Review Questions
      11. Critical Thinking Questions
  3. The Cell
    1. 4 Cell Structure
      1. Introduction
      2. 4.1 Studying Cells
      3. 4.2 Prokaryotic Cells
      4. 4.3 Eukaryotic Cells
      5. 4.4 The Endomembrane System and Proteins
      6. 4.5 The Cytoskeleton
      7. 4.6 Connections between Cells and Cellular Activities
      8. Key Terms
      9. Chapter Summary
      10. Visual Connection Questions
      11. Review Questions
      12. Critical Thinking Questions
    2. 5 Structure and Function of Plasma Membranes
      1. Introduction
      2. 5.1 Components and Structure
      3. 5.2 Passive Transport
      4. 5.3 Active Transport
      5. 5.4 Bulk Transport
      6. Key Terms
      7. Chapter Summary
      8. Visual Connection Questions
      9. Review Questions
      10. Critical Thinking Questions
    3. 6 Metabolism
      1. Introduction
      2. 6.1 Energy and Metabolism
      3. 6.2 Potential, Kinetic, Free, and Activation Energy
      4. 6.3 The Laws of Thermodynamics
      5. 6.4 ATP: Adenosine Triphosphate
      6. 6.5 Enzymes
      7. Key Terms
      8. Chapter Summary
      9. Visual Connection Questions
      10. Review Questions
      11. Critical Thinking Questions
    4. 7 Cellular Respiration
      1. Introduction
      2. 7.1 Energy in Living Systems
      3. 7.2 Glycolysis
      4. 7.3 Oxidation of Pyruvate and the Citric Acid Cycle
      5. 7.4 Oxidative Phosphorylation
      6. 7.5 Metabolism without Oxygen
      7. 7.6 Connections of Carbohydrate, Protein, and Lipid Metabolic Pathways
      8. 7.7 Regulation of Cellular Respiration
      9. Key Terms
      10. Chapter Summary
      11. Visual Connection Questions
      12. Review Questions
      13. Critical Thinking Questions
    5. 8 Photosynthesis
      1. Introduction
      2. 8.1 Overview of Photosynthesis
      3. 8.2 The Light-Dependent Reactions of Photosynthesis
      4. 8.3 Using Light Energy to Make Organic Molecules
      5. Key Terms
      6. Chapter Summary
      7. Visual Connection Questions
      8. Review Questions
      9. Critical Thinking Questions
    6. 9 Cell Communication
      1. Introduction
      2. 9.1 Signaling Molecules and Cellular Receptors
      3. 9.2 Propagation of the Signal
      4. 9.3 Response to the Signal
      5. 9.4 Signaling in Single-Celled Organisms
      6. Key Terms
      7. Chapter Summary
      8. Visual Connection Questions
      9. Review Questions
      10. Critical Thinking Questions
    7. 10 Cell Reproduction
      1. Introduction
      2. 10.1 Cell Division
      3. 10.2 The Cell Cycle
      4. 10.3 Control of the Cell Cycle
      5. 10.4 Cancer and the Cell Cycle
      6. 10.5 Prokaryotic Cell Division
      7. Key Terms
      8. Chapter Summary
      9. Visual Connection Questions
      10. Review Questions
      11. Critical Thinking Questions
  4. Genetics
    1. 11 Meiosis and Sexual Reproduction
      1. Introduction
      2. 11.1 The Process of Meiosis
      3. 11.2 Sexual Reproduction
      4. Key Terms
      5. Chapter Summary
      6. Visual Connection Questions
      7. Review Questions
      8. Critical Thinking Questions
    2. 12 Mendel's Experiments and Heredity
      1. Introduction
      2. 12.1 Mendel’s Experiments and the Laws of Probability
      3. 12.2 Characteristics and Traits
      4. 12.3 Laws of Inheritance
      5. Key Terms
      6. Chapter Summary
      7. Visual Connection Questions
      8. Review Questions
      9. Critical Thinking Questions
    3. 13 Modern Understandings of Inheritance
      1. Introduction
      2. 13.1 Chromosomal Theory and Genetic Linkage
      3. 13.2 Chromosomal Basis of Inherited Disorders
      4. Key Terms
      5. Chapter Summary
      6. Visual Connection Questions
      7. Review Questions
      8. Critical Thinking Questions
    4. 14 DNA Structure and Function
      1. Introduction
      2. 14.1 Historical Basis of Modern Understanding
      3. 14.2 DNA Structure and Sequencing
      4. 14.3 Basics of DNA Replication
      5. 14.4 DNA Replication in Prokaryotes
      6. 14.5 DNA Replication in Eukaryotes
      7. 14.6 DNA Repair
      8. Key Terms
      9. Chapter Summary
      10. Visual Connection Questions
      11. Review Questions
      12. Critical Thinking Questions
    5. 15 Genes and Proteins
      1. Introduction
      2. 15.1 The Genetic Code
      3. 15.2 Prokaryotic Transcription
      4. 15.3 Eukaryotic Transcription
      5. 15.4 RNA Processing in Eukaryotes
      6. 15.5 Ribosomes and Protein Synthesis
      7. Key Terms
      8. Chapter Summary
      9. Visual Connection Questions
      10. Review Questions
      11. Critical Thinking Questions
    6. 16 Gene Expression
      1. Introduction
      2. 16.1 Regulation of Gene Expression
      3. 16.2 Prokaryotic Gene Regulation
      4. 16.3 Eukaryotic Epigenetic Gene Regulation
      5. 16.4 Eukaryotic Transcription Gene Regulation
      6. 16.5 Eukaryotic Post-transcriptional Gene Regulation
      7. 16.6 Eukaryotic Translational and Post-translational Gene Regulation
      8. 16.7 Cancer and Gene Regulation
      9. Key Terms
      10. Chapter Summary
      11. Visual Connection Questions
      12. Review Questions
      13. Critical Thinking Questions
    7. 17 Biotechnology and Genomics
      1. Introduction
      2. 17.1 Biotechnology
      3. 17.2 Mapping Genomes
      4. 17.3 Whole-Genome Sequencing
      5. 17.4 Applying Genomics
      6. 17.5 Genomics and Proteomics
      7. Key Terms
      8. Chapter Summary
      9. Visual Connection Questions
      10. Review Questions
      11. Critical Thinking Questions
  5. Evolutionary Processes
    1. 18 Evolution and the Origin of Species
      1. Introduction
      2. 18.1 Understanding Evolution
      3. 18.2 Formation of New Species
      4. 18.3 Reconnection and Speciation Rates
      5. Key Terms
      6. Chapter Summary
      7. Visual Connection Questions
      8. Review Questions
      9. Critical Thinking Questions
    2. 19 The Evolution of Populations
      1. Introduction
      2. 19.1 Population Evolution
      3. 19.2 Population Genetics
      4. 19.3 Adaptive Evolution
      5. Key Terms
      6. Chapter Summary
      7. Visual Connection Questions
      8. Review Questions
      9. Critical Thinking Questions
    3. 20 Phylogenies and the History of Life
      1. Introduction
      2. 20.1 Organizing Life on Earth
      3. 20.2 Determining Evolutionary Relationships
      4. 20.3 Perspectives on the Phylogenetic Tree
      5. Key Terms
      6. Chapter Summary
      7. Visual Connection Questions
      8. Review Questions
      9. Critical Thinking Questions
  6. Biological Diversity
    1. 21 Viruses
      1. Introduction
      2. 21.1 Viral Evolution, Morphology, and Classification
      3. 21.2 Virus Infections and Hosts
      4. 21.3 Prevention and Treatment of Viral Infections
      5. 21.4 Other Acellular Entities: Prions and Viroids
      6. Key Terms
      7. Chapter Summary
      8. Visual Connection Questions
      9. Review Questions
      10. Critical Thinking Questions
    2. 22 Prokaryotes: Bacteria and Archaea
      1. Introduction
      2. 22.1 Prokaryotic Diversity
      3. 22.2 Structure of Prokaryotes: Bacteria and Archaea
      4. 22.3 Prokaryotic Metabolism
      5. 22.4 Bacterial Diseases in Humans
      6. 22.5 Beneficial Prokaryotes
      7. Key Terms
      8. Chapter Summary
      9. Visual Connection Questions
      10. Review Questions
      11. Critical Thinking Questions
    3. 23 Protists
      1. Introduction
      2. 23.1 Eukaryotic Origins
      3. 23.2 Characteristics of Protists
      4. 23.3 Groups of Protists
      5. 23.4 Ecology of Protists
      6. Key Terms
      7. Chapter Summary
      8. Visual Connection Questions
      9. Review Questions
      10. Critical Thinking Questions
    4. 24 Fungi
      1. Introduction
      2. 24.1 Characteristics of Fungi
      3. 24.2 Classifications of Fungi
      4. 24.3 Ecology of Fungi
      5. 24.4 Fungal Parasites and Pathogens
      6. 24.5 Importance of Fungi in Human Life
      7. Key Terms
      8. Chapter Summary
      9. Visual Connection Questions
      10. Review Questions
      11. Critical Thinking Questions
    5. 25 Seedless Plants
      1. Introduction
      2. 25.1 Early Plant Life
      3. 25.2 Green Algae: Precursors of Land Plants
      4. 25.3 Bryophytes
      5. 25.4 Seedless Vascular Plants
      6. Key Terms
      7. Chapter Summary
      8. Visual Connection Questions
      9. Review Questions
      10. Critical Thinking Questions
    6. 26 Seed Plants
      1. Introduction
      2. 26.1 Evolution of Seed Plants
      3. 26.2 Gymnosperms
      4. 26.3 Angiosperms
      5. 26.4 The Role of Seed Plants
      6. Key Terms
      7. Chapter Summary
      8. Visual Connection Questions
      9. Review Questions
      10. Critical Thinking Questions
    7. 27 Introduction to Animal Diversity
      1. Introduction
      2. 27.1 Features of the Animal Kingdom
      3. 27.2 Features Used to Classify Animals
      4. 27.3 Animal Phylogeny
      5. 27.4 The Evolutionary History of the Animal Kingdom
      6. Key Terms
      7. Chapter Summary
      8. Visual Connection Questions
      9. Review Questions
      10. Critical Thinking Questions
    8. 28 Invertebrates
      1. Introduction
      2. 28.1 Phylum Porifera
      3. 28.2 Phylum Cnidaria
      4. 28.3 Superphylum Lophotrochozoa: Flatworms, Rotifers, and Nemerteans
      5. 28.4 Superphylum Lophotrochozoa: Molluscs and Annelids
      6. 28.5 Superphylum Ecdysozoa: Nematodes and Tardigrades
      7. 28.6 Superphylum Ecdysozoa: Arthropods
      8. 28.7 Superphylum Deuterostomia
      9. Key Terms
      10. Chapter Summary
      11. Visual Connection Questions
      12. Review Questions
      13. Critical Thinking Questions
    9. 29 Vertebrates
      1. Introduction
      2. 29.1 Chordates
      3. 29.2 Fishes
      4. 29.3 Amphibians
      5. 29.4 Reptiles
      6. 29.5 Birds
      7. 29.6 Mammals
      8. 29.7 The Evolution of Primates
      9. Key Terms
      10. Chapter Summary
      11. Visual Connection Questions
      12. Review Questions
      13. Critical Thinking Questions
  7. Plant Structure and Function
    1. 30 Plant Form and Physiology
      1. Introduction
      2. 30.1 The Plant Body
      3. 30.2 Stems
      4. 30.3 Roots
      5. 30.4 Leaves
      6. 30.5 Transport of Water and Solutes in Plants
      7. 30.6 Plant Sensory Systems and Responses
      8. Key Terms
      9. Chapter Summary
      10. Visual Connection Questions
      11. Review Questions
      12. Critical Thinking Questions
    2. 31 Soil and Plant Nutrition
      1. Introduction
      2. 31.1 Nutritional Requirements of Plants
      3. 31.2 The Soil
      4. 31.3 Nutritional Adaptations of Plants
      5. Key Terms
      6. Chapter Summary
      7. Visual Connection Questions
      8. Review Questions
      9. Critical Thinking Questions
    3. 32 Plant Reproduction
      1. Introduction
      2. 32.1 Reproductive Development and Structure
      3. 32.2 Pollination and Fertilization
      4. 32.3 Asexual Reproduction
      5. Key Terms
      6. Chapter Summary
      7. Visual Connection Questions
      8. Review Questions
      9. Critical Thinking Questions
  8. Animal Structure and Function
    1. 33 The Animal Body: Basic Form and Function
      1. Introduction
      2. 33.1 Animal Form and Function
      3. 33.2 Animal Primary Tissues
      4. 33.3 Homeostasis
      5. Key Terms
      6. Chapter Summary
      7. Visual Connection Questions
      8. Review Questions
      9. Critical Thinking Questions
    2. 34 Animal Nutrition and the Digestive System
      1. Introduction
      2. 34.1 Digestive Systems
      3. 34.2 Nutrition and Energy Production
      4. 34.3 Digestive System Processes
      5. 34.4 Digestive System Regulation
      6. Key Terms
      7. Chapter Summary
      8. Visual Connection Questions
      9. Review Questions
      10. Critical Thinking Questions
    3. 35 The Nervous System
      1. Introduction
      2. 35.1 Neurons and Glial Cells
      3. 35.2 How Neurons Communicate
      4. 35.3 The Central Nervous System
      5. 35.4 The Peripheral Nervous System
      6. 35.5 Nervous System Disorders
      7. Key Terms
      8. Chapter Summary
      9. Visual Connection Questions
      10. Review Questions
      11. Critical Thinking Questions
    4. 36 Sensory Systems
      1. Introduction
      2. 36.1 Sensory Processes
      3. 36.2 Somatosensation
      4. 36.3 Taste and Smell
      5. 36.4 Hearing and Vestibular Sensation
      6. 36.5 Vision
      7. Key Terms
      8. Chapter Summary
      9. Visual Connection Questions
      10. Review Questions
      11. Critical Thinking Questions
    5. 37 The Endocrine System
      1. Introduction
      2. 37.1 Types of Hormones
      3. 37.2 How Hormones Work
      4. 37.3 Regulation of Body Processes
      5. 37.4 Regulation of Hormone Production
      6. 37.5 Endocrine Glands
      7. Key Terms
      8. Chapter Summary
      9. Visual Connection Questions
      10. Review Questions
      11. Critical Thinking Questions
    6. 38 The Musculoskeletal System
      1. Introduction
      2. 38.1 Types of Skeletal Systems
      3. 38.2 Bone
      4. 38.3 Joints and Skeletal Movement
      5. 38.4 Muscle Contraction and Locomotion
      6. Key Terms
      7. Chapter Summary
      8. Visual Connection Questions
      9. Review Questions
      10. Critical Thinking Questions
    7. 39 The Respiratory System
      1. Introduction
      2. 39.1 Systems of Gas Exchange
      3. 39.2 Gas Exchange across Respiratory Surfaces
      4. 39.3 Breathing
      5. 39.4 Transport of Gases in Human Bodily Fluids
      6. Key Terms
      7. Chapter Summary
      8. Visual Connection Questions
      9. Review Questions
      10. Critical Thinking Questions
    8. 40 The Circulatory System
      1. Introduction
      2. 40.1 Overview of the Circulatory System
      3. 40.2 Components of the Blood
      4. 40.3 Mammalian Heart and Blood Vessels
      5. 40.4 Blood Flow and Blood Pressure Regulation
      6. Key Terms
      7. Chapter Summary
      8. Visual Connection Questions
      9. Review Questions
      10. Critical Thinking Questions
    9. 41 Osmotic Regulation and Excretion
      1. Introduction
      2. 41.1 Osmoregulation and Osmotic Balance
      3. 41.2 The Kidneys and Osmoregulatory Organs
      4. 41.3 Excretion Systems
      5. 41.4 Nitrogenous Wastes
      6. 41.5 Hormonal Control of Osmoregulatory Functions
      7. Key Terms
      8. Chapter Summary
      9. Visual Connection Questions
      10. Review Questions
      11. Critical Thinking Questions
    10. 42 The Immune System
      1. Introduction
      2. 42.1 Innate Immune Response
      3. 42.2 Adaptive Immune Response
      4. 42.3 Antibodies
      5. 42.4 Disruptions in the Immune System
      6. Key Terms
      7. Chapter Summary
      8. Visual Connection Questions
      9. Review Questions
      10. Critical Thinking Questions
    11. 43 Animal Reproduction and Development
      1. Introduction
      2. 43.1 Reproduction Methods
      3. 43.2 Fertilization
      4. 43.3 Human Reproductive Anatomy and Gametogenesis
      5. 43.4 Hormonal Control of Human Reproduction
      6. 43.5 Human Pregnancy and Birth
      7. 43.6 Fertilization and Early Embryonic Development
      8. 43.7 Organogenesis and Vertebrate Formation
      9. Key Terms
      10. Chapter Summary
      11. Visual Connection Questions
      12. Review Questions
      13. Critical Thinking Questions
  9. Ecology
    1. 44 Ecology and the Biosphere
      1. Introduction
      2. 44.1 The Scope of Ecology
      3. 44.2 Biogeography
      4. 44.3 Terrestrial Biomes
      5. 44.4 Aquatic Biomes
      6. 44.5 Climate and the Effects of Global Climate Change
      7. Key Terms
      8. Chapter Summary
      9. Visual Connection Questions
      10. Review Questions
      11. Critical Thinking Questions
    2. 45 Population and Community Ecology
      1. Introduction
      2. 45.1 Population Demography
      3. 45.2 Life Histories and Natural Selection
      4. 45.3 Environmental Limits to Population Growth
      5. 45.4 Population Dynamics and Regulation
      6. 45.5 Human Population Growth
      7. 45.6 Community Ecology
      8. 45.7 Behavioral Biology: Proximate and Ultimate Causes of Behavior
      9. Key Terms
      10. Chapter Summary
      11. Visual Connection Questions
      12. Review Questions
      13. Critical Thinking Questions
    3. 46 Ecosystems
      1. Introduction
      2. 46.1 Ecology of Ecosystems
      3. 46.2 Energy Flow through Ecosystems
      4. 46.3 Biogeochemical Cycles
      5. Key Terms
      6. Chapter Summary
      7. Visual Connection Questions
      8. Review Questions
      9. Critical Thinking Questions
    4. 47 Conservation Biology and Biodiversity
      1. Introduction
      2. 47.1 The Biodiversity Crisis
      3. 47.2 The Importance of Biodiversity to Human Life
      4. 47.3 Threats to Biodiversity
      5. 47.4 Preserving Biodiversity
      6. Key Terms
      7. Chapter Summary
      8. Visual Connection Questions
      9. Review Questions
      10. Critical Thinking Questions
  10. A | The Periodic Table of Elements
  11. B | Geological Time
  12. C | Measurements and the Metric System
  13. Index

Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about the genetic code, what would be the shortest possible codon length? Explain.


Discuss how degeneracy of the genetic code makes cells more robust to mutations.


A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG

What is the sequence of the amino acid chain this mRNA makes when it is translated?


If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?


In your own words, describe the difference between rho-dependent and rho-independent termination of transcription in prokaryotes.


A fragment of bacterial DNA reads:


Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)


A scientist observes that a cell has an RNA polymerase deficiency that prevents it from making proteins. Describe three additional observations that would together support the conclusion that a defect in RNA polymerase I activity, and not problems with the other polymerases, causes the defect.


Chronic lymphocytic leukemia patients often harbor nonsense mutations in their spliceosome machinery. Describe how this mutation of the spliceosome would change the final location and sequence of a pre-mRNA.


Transcribe and translate the following DNA sequence (nontemplate strand): 5'-ATGGCCGGTTATTAAGCA-3'


Explain how single nucleotide changes can have vastly different effects on protein function.


A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)


Want to cite, share, or modify this book? This book is Creative Commons Attribution License 4.0 and you must attribute OpenStax.

Attribution information
  • If you are redistributing all or part of this book in a print format, then you must include on every physical page the following attribution:
    Access for free at
  • If you are redistributing all or part of this book in a digital format, then you must include on every digital page view the following attribution:
    Access for free at
Citation information

© Jan 18, 2020 OpenStax. Textbook content produced by OpenStax is licensed under a Creative Commons Attribution License 4.0 license. The OpenStax name, OpenStax logo, OpenStax book covers, OpenStax CNX name, and OpenStax CNX logo are not subject to the Creative Commons license and may not be reproduced without the prior and express written consent of Rice University.